vault backup: 2022-09-06 20:11:55
This commit is contained in:
parent
30f85b2093
commit
99e9f02118
2
.obsidian/graph.json
vendored
2
.obsidian/graph.json
vendored
|
@ -39,6 +39,6 @@
|
|||
"repelStrength": 10,
|
||||
"linkStrength": 1,
|
||||
"linkDistance": 250,
|
||||
"scale": 1.3711753906745523,
|
||||
"scale": 0.9747267101258579,
|
||||
"close": true
|
||||
}
|
472
.obsidian/themes/Atom.css
vendored
472
.obsidian/themes/Atom.css
vendored
|
@ -1,472 +0,0 @@
|
|||
.theme-dark {
|
||||
--background-primary: #272b34;
|
||||
--background-primary-alt: #20242b;
|
||||
--background-secondary: #20242b;
|
||||
--background-secondary-alt: #1a1e24;
|
||||
--background-accent: #000;
|
||||
--background-modifier-border: #424958;
|
||||
--background-modifier-form-field: rgba(0, 0, 0, 0.3);
|
||||
--background-modifier-form-field-highlighted: rgba(0, 0, 0, 0.22);
|
||||
--background-modifier-box-shadow: rgba(0, 0, 0, 0.3);
|
||||
--background-modifier-success: #539126;
|
||||
--background-modifier-error: #3d0000;
|
||||
--background-modifier-error-rgb: 61, 0, 0;
|
||||
--background-modifier-error-hover: #470000;
|
||||
--background-modifier-cover: rgba(0, 0, 0, 0.6);
|
||||
--text-accent: #61afef;
|
||||
--text-accent-hover: #69bafd;
|
||||
--text-normal: #dcddde;
|
||||
--text-muted: #888;
|
||||
--text-faint: rgb(81, 86, 99);
|
||||
--text-error: #e16d76;
|
||||
--text-error-hover: #c9626a;
|
||||
--text-highlight-bg: rgba(255, 255, 0, 0.4);
|
||||
--text-selection: rgba(0, 122, 255, 0.2);
|
||||
--text-on-accent: #dcddde;
|
||||
--interactive-normal: #20242b;
|
||||
--interactive-hover: #353b47;
|
||||
--interactive-accent: #4c78cc;
|
||||
--interactive-accent-rgb: 76, 120, 204;
|
||||
--interactive-accent-hover: #5082df;
|
||||
--scrollbar-active-thumb-bg: rgba(255, 255, 255, 0.2);
|
||||
--scrollbar-bg: rgba(255, 255, 255, 0.05);
|
||||
--scrollbar-thumb-bg: rgba(255, 255, 255, 0.1);
|
||||
--panel-border-color: #18191e;
|
||||
--gray-1: #5C6370;
|
||||
--gray-2: #abb2bf;
|
||||
--red: #e06c75;
|
||||
--orange: #d19a66;
|
||||
--green: #98c379;
|
||||
--aqua: #56b6c2;
|
||||
--purple: #c678dd;
|
||||
--blue: #61afef;
|
||||
--yellow: #e5c07b;
|
||||
}
|
||||
|
||||
.theme-light {
|
||||
--background-primary: #fafafa;
|
||||
--background-primary-alt: #eaeaeb;
|
||||
--background-secondary: #eaeaeb;
|
||||
--background-secondary-alt: #dbdbdc;
|
||||
--background-accent: #fff;
|
||||
--background-modifier-border: #dbdbdc;
|
||||
--background-modifier-form-field: #fff;
|
||||
--background-modifier-form-field-highlighted: #fff;
|
||||
--background-modifier-box-shadow: rgba(0, 0, 0, 0.1);
|
||||
--background-modifier-success: #A4E7C3;
|
||||
--background-modifier-error: #e68787;
|
||||
--background-modifier-error-rgb: 230, 135, 135;
|
||||
--background-modifier-error-hover: #FF9494;
|
||||
--background-modifier-cover: rgba(0, 0, 0, 0.8);
|
||||
--text-accent: #1592ff;
|
||||
--text-accent-hover: #2d9dff;
|
||||
--text-normal: #383a42;
|
||||
--text-muted: #8e8e90;
|
||||
--text-faint: #999999;
|
||||
--text-error: #e75545;
|
||||
--text-error-hover: #f86959;
|
||||
--text-highlight-bg: rgba(255, 255, 0, 0.4);
|
||||
--text-selection: rgba(0, 122, 255, 0.15);
|
||||
--text-on-accent: #f2f2f2;
|
||||
--interactive-normal: #eaeaeb;
|
||||
--interactive-hover: #dbdbdc;
|
||||
--interactive-accent-rgb: 21, 146, 255;
|
||||
--interactive-accent: #5871ef;
|
||||
--interactive-accent-hover: #445bd1;
|
||||
--scrollbar-active-thumb-bg: rgba(0, 0, 0, 0.2);
|
||||
--scrollbar-bg: rgba(0, 0, 0, 0.05);
|
||||
--scrollbar-thumb-bg: rgba(0, 0, 0, 0.1);
|
||||
--panel-border-color: #dbdbdc;
|
||||
--gray-1: #383a42;
|
||||
--gray-2: #383a42;
|
||||
--red: #e75545;
|
||||
--green: #4ea24c;
|
||||
--blue: #3d74f6;
|
||||
--purple: #a625a4;
|
||||
--aqua: #0084bc;
|
||||
--yellow: #e35649;
|
||||
--orange: #986800;
|
||||
}
|
||||
|
||||
body {
|
||||
-webkit-font-smoothing: auto;
|
||||
}
|
||||
|
||||
.titlebar {
|
||||
background-color: var(--background-secondary-alt);
|
||||
}
|
||||
|
||||
.titlebar-inner {
|
||||
color: var(--text-normal);
|
||||
}
|
||||
|
||||
.tooltip {
|
||||
background-color: var(--background-secondary-alt);
|
||||
color: var(--text-muted);
|
||||
}
|
||||
|
||||
.tooltip:not(.mod-right):not(.mod-left):not(.mod-top) .tooltip-arrow {
|
||||
border-bottom-color: var(--background-secondary-alt) !important;
|
||||
}
|
||||
|
||||
.mod-right .tooltip-arrow {
|
||||
border-right-color: var(--background-secondary-alt) !important;
|
||||
}
|
||||
|
||||
.mod-left .tooltip-arrow {
|
||||
border-left-color: var(--background-secondary-alt) !important;
|
||||
}
|
||||
|
||||
.mod-top .tooltip-arrow {
|
||||
border-top-color: var(--background-secondary-alt) !important;
|
||||
}
|
||||
|
||||
.dropdown {
|
||||
cursor: pointer;
|
||||
background-image: url(data:image/svg+xml;charset=US-ASCII,%3Csvg%20xmlns%3D%22http%3A%2F%2Fwww.w3.org%2F2000%2Fsvg%22%20width%3D%22292.4%22%20height%3D%22292.4%22%3E%3Cpath%20fill%3D%22%234c78cc%22%20d%3D%22M287%2069.4a17.6%2017.6%200%200%200-13-5.4H18.4c-5%200-9.3%201.8-12.9%205.4A17.6%2017.6%200%200%200%200%2082.2c0%205%201.8%209.3%205.4%2012.9l128%20127.9c3.6%203.6%207.8%205.4%2012.8%205.4s9.2-1.8%2012.8-5.4L287%2095c3.5-3.5%205.4-7.8%205.4-12.8%200-5-1.9-9.2-5.5-12.8z%22%2F%3E%3C%2Fsvg%3E);
|
||||
}
|
||||
|
||||
.dropdown:hover {
|
||||
background-color: var(--background-modifier-form-field);
|
||||
}
|
||||
|
||||
.search-result-file-title {
|
||||
color: var(--blue);
|
||||
}
|
||||
|
||||
li {
|
||||
padding-top: 0.5px;
|
||||
padding-bottom: 0.5px;
|
||||
}
|
||||
|
||||
a.tag, a.tag:hover {
|
||||
color: var(--yellow);
|
||||
background-color: var(--background-primary-alt);
|
||||
padding: 2px 4px;
|
||||
border-radius: 4px;
|
||||
}
|
||||
|
||||
.markdown-preview-view .task-list-item-checkbox {
|
||||
-webkit-appearance: none;
|
||||
box-sizing: border-box;
|
||||
border: 1px solid var(--text-muted);
|
||||
border-radius: 2px;
|
||||
position: relative;
|
||||
width: 1.3em;
|
||||
height: 1.3em;
|
||||
margin: 0;
|
||||
filter: none;
|
||||
outline: none;
|
||||
margin-right: 4px;
|
||||
margin-bottom: 2px;
|
||||
cursor: pointer;
|
||||
vertical-align: baseline;
|
||||
}
|
||||
|
||||
.markdown-preview-view .task-list-item-checkbox:checked {
|
||||
border: none;
|
||||
background-color: var(--interactive-accent);
|
||||
}
|
||||
|
||||
.markdown-preview-view .task-list-item-checkbox:checked::before {
|
||||
content: ' ';
|
||||
position: absolute;
|
||||
background-color: white;
|
||||
left: 2px;
|
||||
top: 2px;
|
||||
right: 2px;
|
||||
bottom: 2px;
|
||||
-webkit-mask-image: url('data:image/svg+xml,%3Csvg xmlns=\'http://www.w3.org/2000/svg\' viewBox=\'0 0 14 14\'%3E%3Cpolygon points=\'5.5 11.9993304 14 3.49933039 12.5 2 5.5 8.99933039 1.5 4.9968652 0 6.49933039\'%3E%3C/polygon%3E%3C/svg%3E');
|
||||
}
|
||||
|
||||
.markdown-preview-view .task-list-item.is-checked a {
|
||||
filter: saturate(0.8) brightness(0.7);
|
||||
}
|
||||
|
||||
.cm-formatting-task {
|
||||
font-family: var(--font-monospace);
|
||||
}
|
||||
|
||||
.nav-file, .nav-folder {
|
||||
padding: 1px 2px;
|
||||
}
|
||||
|
||||
.nav-file-title, .nav-folder-title {
|
||||
width: 100%;
|
||||
cursor: default;
|
||||
display: flex;
|
||||
align-items: baseline;
|
||||
flex-direction: row;
|
||||
--text-normal: var(--text-muted);
|
||||
}
|
||||
|
||||
body:not(.is-grabbing) .nav-file .nav-file-title:hover:not(.is-active), body:not(.is-grabbing) .nav-folder .nav-folder-title:hover:not(.is-active) {
|
||||
--background-secondary-alt: transparent;
|
||||
}
|
||||
|
||||
.nav-file .is-active {
|
||||
--background-secondary-alt: var(--interactive-accent);
|
||||
--text-normal: #ffffff;
|
||||
}
|
||||
|
||||
.nav-file-title-content, .nav-folder-title-content {
|
||||
text-indent: 0;
|
||||
white-space: nowrap;
|
||||
text-overflow: ellipsis;
|
||||
overflow: hidden;
|
||||
display: block;
|
||||
}
|
||||
|
||||
.markdown-preview-view.is-readable-line-width .markdown-preview-section, .markdown-source-view.is-readable-line-width .CodeMirror {
|
||||
max-width: 900px !important;
|
||||
line-height: 26px;
|
||||
}
|
||||
|
||||
blockquote {
|
||||
margin: 20px 0;
|
||||
border-radius: 4px !important;
|
||||
}
|
||||
|
||||
body {
|
||||
--font-monospace: 'Fira Code', 'Source Code Pro', monospace;
|
||||
}
|
||||
|
||||
mjx-container[jax='CHTML'] {
|
||||
text-align: left;
|
||||
outline: none;
|
||||
}
|
||||
|
||||
.math-block {
|
||||
font-size: 1.25em;
|
||||
}
|
||||
|
||||
.cm-s-obsidian pre.HyperMD-codeblock, .cm-s-obsidian span.cm-inline-code, .cm-s-obsidian span.cm-math:not(.cm-formatting-math-begin):not(.cm-formatting-math-end), .markdown-preview-view code {
|
||||
/* fix `` tag color */
|
||||
color: #98c379;
|
||||
}
|
||||
|
||||
.cm-s-obsidian span.cm-inline-code, .cm-s-obsidian span.cm-math, .cm-s-obsidian span.hmd-fold-math-placeholder {
|
||||
/* fix tag size */
|
||||
font-weight: 100;
|
||||
font-style: normal;
|
||||
}
|
||||
|
||||
.markdown-preview-view code {
|
||||
vertical-align: 0;
|
||||
word-break: break-word;
|
||||
}
|
||||
|
||||
.markdown-preview-section:not(:first-child) h1, .markdown-preview-section:not(:first-child) h2, .markdown-preview-section:not(:first-child) h3, .markdown-preview-section:not(:first-child) h4, .markdown-preview-section:not(:first-child) h5, .markdown-preview-section:not(:first-child) h6 {
|
||||
margin-top: 40px !important;
|
||||
}
|
||||
|
||||
.markdown-preview-section h1, .markdown-preview-section h2, .markdown-preview-section h3, .markdown-preview-section h4, .markdown-preview-section h5, .markdown-preview-section h6 {
|
||||
line-height: 1.2;
|
||||
}
|
||||
|
||||
h1, h2, h3, h4, h5, h6, strong, b, .view-header-title {
|
||||
font-weight: 600;
|
||||
}
|
||||
|
||||
.workspace>.workspace-split>.workspace-leaf:first-of-type:last-of-type .view-header {
|
||||
border: none;
|
||||
}
|
||||
|
||||
.status-bar, .side-dock.mod-right, .side-dock.mod-left {
|
||||
border-color: var(--panel-border-color);
|
||||
border-width: 1px;
|
||||
}
|
||||
|
||||
.status-bar {
|
||||
--bar-vertical-padding: 4px;
|
||||
--bar-height: calc(22px + (var(--bar-vertical-padding) * 2));
|
||||
line-height: 20px;
|
||||
padding: 0 20px;
|
||||
height: var(--bar-height);
|
||||
max-height: var(--bar-height);
|
||||
min-height: var(--bar-height);
|
||||
overflow: hidden;
|
||||
}
|
||||
|
||||
.status-bar-item {
|
||||
margin: auto 0;
|
||||
}
|
||||
|
||||
.status-bar-item>* {
|
||||
padding-top: var(--bar-vertical-padding) !important;
|
||||
padding-bottom: var(--bar-vertical-padding) !important;
|
||||
}
|
||||
|
||||
.side-dock-plugin-panel-inner {
|
||||
padding-left: 6px;
|
||||
}
|
||||
|
||||
a, .markdown-preview-view .internal-link {
|
||||
text-decoration: none;
|
||||
}
|
||||
|
||||
a:hover, .markdown-preview-view .internal-link:hover {
|
||||
text-decoration: underline;
|
||||
}
|
||||
|
||||
.theme-dark :not(pre)>code[class*='language-'], .theme-dark pre[class*='language-'] {
|
||||
background: var(--background-primary-alt);
|
||||
}
|
||||
|
||||
.theme-light :not(pre)>code[class*='language-'], .theme-light pre[class*='language-'] {
|
||||
background: var(--background-primary);
|
||||
box-shadow: inset 0 0 0 1px var(--background-primary-alt);
|
||||
border-radius: 4px;
|
||||
}
|
||||
|
||||
.markdown-embed:not(.hover-popover .markdown-embed), .file-embed {
|
||||
margin: 0;
|
||||
border-radius: 4px;
|
||||
margin: 0 !important;
|
||||
margin-inline-start: 30px !important;
|
||||
margin-inline-end: 30px !important;
|
||||
}
|
||||
|
||||
.markdown-embed {
|
||||
border: 1px solid var(--background-modifier-border);
|
||||
border-left-width: 5px;
|
||||
}
|
||||
|
||||
.markdown-embed .markdown-preview-view {
|
||||
padding: 0 20px;
|
||||
}
|
||||
|
||||
.markdown-embed-link, .file-embed-link {
|
||||
left: 8px;
|
||||
right: unset;
|
||||
}
|
||||
|
||||
.theme-light .token.operator, .theme-light .token.entity, .theme-light .token.url, .theme-light .language-css .token.string, .theme-light .style .token.string {
|
||||
background: transparent;
|
||||
}
|
||||
|
||||
/* Source: https://github.com/AGMStudio/prism-theme-one-dark */
|
||||
|
||||
code[class*='language-'], pre[class*='language-'] {
|
||||
text-align: left !important;
|
||||
white-space: pre !important;
|
||||
word-spacing: normal !important;
|
||||
word-break: normal !important;
|
||||
word-wrap: normal !important;
|
||||
line-height: 1.5 !important;
|
||||
-moz-tab-size: 4 !important;
|
||||
-o-tab-size: 4 !important;
|
||||
tab-size: 4 !important;
|
||||
-webkit-hyphens: none !important;
|
||||
-moz-hyphens: none !important;
|
||||
-ms-hyphens: none !important;
|
||||
hyphens: none !important;
|
||||
}
|
||||
|
||||
/* Code blocks */
|
||||
|
||||
pre[class*='language-'] {
|
||||
padding: 1em !important;
|
||||
margin: .5em 0 !important;
|
||||
overflow: auto !important;
|
||||
}
|
||||
|
||||
/* Inline code */
|
||||
|
||||
:not(pre)>code[class*='language-'] {
|
||||
padding: .1em !important;
|
||||
border-radius: .3em !important;
|
||||
white-space: normal !important;
|
||||
}
|
||||
|
||||
.token.comment, .token.prolog, .token.doctype, .token.cdata {
|
||||
color: var(--gray-1) !important;
|
||||
}
|
||||
|
||||
.token.punctuation {
|
||||
color: var(--gray-2) !important;
|
||||
}
|
||||
|
||||
.token.selector, .token.tag {
|
||||
color: var(--red) !important;
|
||||
}
|
||||
|
||||
.token.property, .token.boolean, .token.number, .token.constant, .token.symbol, .token.attr-name, .token.deleted {
|
||||
color: var(--orange) !important;
|
||||
}
|
||||
|
||||
.token.string, .token.char, .token.attr-value, .token.builtin, .token.inserted {
|
||||
color: var(--green) !important;
|
||||
}
|
||||
|
||||
.token.operator, .token.entity, .token.url, .language-css .token.string, .style .token.string {
|
||||
color: var(--aqua) !important;
|
||||
}
|
||||
|
||||
.token.atrule, .token.keyword {
|
||||
color: var(--purple) !important;
|
||||
}
|
||||
|
||||
.token.function, .token.macro.property {
|
||||
color: var(--blue) !important;
|
||||
}
|
||||
|
||||
.token.class-name {
|
||||
color: var(--yellow) !important;
|
||||
}
|
||||
|
||||
.token.regex, .token.important, .token.variable {
|
||||
color: var(--purple) !important;
|
||||
}
|
||||
|
||||
.token.important, .token.bold {
|
||||
font-weight: bold !important;
|
||||
}
|
||||
|
||||
.token.italic {
|
||||
font-style: italic !important;
|
||||
}
|
||||
|
||||
.token.entity {
|
||||
cursor: help !important;
|
||||
}
|
||||
|
||||
pre.line-numbers {
|
||||
position: relative !important;
|
||||
padding-left: 3.8em !important;
|
||||
counter-reset: linenumber !important;
|
||||
}
|
||||
|
||||
pre.line-numbers>code {
|
||||
position: relative !important;
|
||||
}
|
||||
|
||||
.line-numbers .line-numbers-rows {
|
||||
position: absolute !important;
|
||||
pointer-events: none !important;
|
||||
top: 0 !important;
|
||||
font-size: 100% !important;
|
||||
left: -3.8em !important;
|
||||
width: 3em !important;
|
||||
/* works for line-numbers below 1000 lines */
|
||||
letter-spacing: -1px !important;
|
||||
border-right: 0 !important;
|
||||
-webkit-user-select: none !important;
|
||||
-moz-user-select: none !important;
|
||||
-ms-user-select: none !important;
|
||||
user-select: none !important;
|
||||
}
|
||||
|
||||
.line-numbers-rows>span {
|
||||
pointer-events: none !important;
|
||||
display: block !important;
|
||||
counter-increment: linenumber !important;
|
||||
}
|
||||
|
||||
.line-numbers-rows>span:before {
|
||||
content: counter(linenumber) !important;
|
||||
color: var(--syntax-gray-1) !important;
|
||||
display: block !important;
|
||||
padding-right: 0.8em !important;
|
||||
text-align: right !important;
|
||||
}
|
103
OJ notes/pages/Leetcode Repeated-DNA-Sequences.md
Normal file
103
OJ notes/pages/Leetcode Repeated-DNA-Sequences.md
Normal file
|
@ -0,0 +1,103 @@
|
|||
# Leetcode Repeated-DNA-Sequences
|
||||
|
||||
2022-09-06 19:58
|
||||
|
||||
> ##### Data structures:
|
||||
>
|
||||
> #DS #hash_table #string
|
||||
>
|
||||
> ##### Difficulty:
|
||||
>
|
||||
> #coding_problem #difficulty-medium
|
||||
>
|
||||
> ##### Additional tags:
|
||||
>
|
||||
> #leetcode
|
||||
>
|
||||
> ##### Revisions:
|
||||
>
|
||||
> N/A
|
||||
|
||||
##### Links:
|
||||
|
||||
- [Link to problem](https://leetcode.com/problems/repeated-dna-sequences/)
|
||||
|
||||
---
|
||||
|
||||
### Problem
|
||||
|
||||
The **DNA sequence** is composed of a series of nucleotides abbreviated as `'A'`, `'C'`, `'G'`, and `'T'`.
|
||||
|
||||
- For example, `"ACGAATTCCG"` is a **DNA sequence**.
|
||||
|
||||
When studying **DNA**, it is useful to identify repeated sequences within the DNA.
|
||||
|
||||
Given a string `s` that represents a **DNA sequence**, return all the **`10`-letter-long** sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in **any order**.
|
||||
|
||||
#### Examples
|
||||
|
||||
**Example 1:**
|
||||
|
||||
**Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
|
||||
**Output:** ["AAAAACCCCC","CCCCCAAAAA"]
|
||||
|
||||
**Example 2:**
|
||||
|
||||
**Input:** s = "AAAAAAAAAAAAA"
|
||||
**Output:** ["AAAAAAAAAA"]
|
||||
|
||||
#### Constraints
|
||||
|
||||
### Thoughts
|
||||
|
||||
> [!summary]
|
||||
> This is a #hash_table problem.
|
||||
|
||||
The question ask for an answer, and the substrings can
|
||||
overlap. So, using a map is prefered(Why?)
|
||||
|
||||
Two reasons:
|
||||
- Easy way to know if a array is a duplicate (set, map can
|
||||
suffice.)
|
||||
- Keep information on how many duplicates found, so we only
|
||||
append it to the answer the first time we meet it.
|
||||
|
||||
One trip-over hole: in the for loop, upper bound should be:
|
||||
```cpp
|
||||
for (int i = 0, top = s.size() - 9; i < top; i++)
|
||||
^^^
|
||||
```
|
||||
|
||||
Minus 9, because 9 is the extended length for an subarray starting with i.
|
||||
```
|
||||
1234567890
|
||||
^ ^
|
||||
|--------|
|
||||
i i+9
|
||||
|
||||
i + 9 - i + 1 = 10.
|
||||
```
|
||||
|
||||
With these edge-cases taken care of, we can proceed to the
|
||||
solution:
|
||||
|
||||
### Solution
|
||||
|
||||
```cpp
|
||||
class Solution {
|
||||
public:
|
||||
vector<string> findRepeatedDnaSequences(string s) {
|
||||
unordered_map<string, int> used;
|
||||
vector<string> ans = {};
|
||||
for (int i = 0, size = s.size() - 9; i < size; i++) {
|
||||
string tmp = s.substr(i, 10);
|
||||
|
||||
if ((used[tmp]++) == 1) {
|
||||
ans.push_back(tmp);
|
||||
}
|
||||
}
|
||||
|
||||
return ans;
|
||||
}
|
||||
};
|
||||
```
|
Loading…
Reference in a new issue